About
Evelyn Pirnia has a Bachelor's Degree in Computer Science from the University of Hawaii at Manoa. She is currently living in San Francisco. In addition to pursuing her degree, she was the President of a student chapter for the Association for Computing Machinery (ACManoa) and a Math and Science
tutor for her University's Online Learning Academy. Her areas of interest include database management, data science, and web development. In her free time, she likes to read and practice photography.
Activity
April 2017 - ACManoa Outreach Workshops
My team and I mentored high school students from Sacred Hearts Academy and Punahou High School. This workshop focused primarily on introducing the students to web development tools such as Git, HTML, CSS, and Javascript.
October 2016 - AAUW Scholarship for the Grace Hopper Conference
I attended the world's largest gathering of women technologists on scholarship from AAUW Honolulu. One of the many inspirational speakers was the Chief Technology Officer (CTO) of the United States of America, Megan Smith.
My team and I mentored high school students from Sacred Hearts Academy who were interested in programming. The students were introduced to Git, Java, and the command line. It was an opportunity to give back to the community and foster interest in the ICS program at the University.
My team and I implemented a Bike Share Hawaii webpage where both businesses and users are able to log in and help balance the flow of traffic. Tangible incentives including reduced meals, tickets, drinks, and healthy activity are used to encourage the use of bikes that will counteract the usual flow of traffic. The Hackathon winners were invited to discuss our projects on Hawaii Public Radio's Bytemarks Cafe. Listen here.
Projects
Written in Python3 and MySQL, Blake Larson and I implemented a DDL processing component of a parallel
SQL processing system. DDLs submitted to the system are translated into corresponding DDLs for each
individual DBMS instance in the cluster and executed. With every MySQL statement executed, a catalog
database is updated to store metadata about what data is stored for each table.
Written in Java, the program takes in a filename of a file with contents in the Clustal Omega alignment
format, then determines the distance for all pairwise alignment induced by the multiple sequence
alignment. The distance between two sequences are computed as the sum of all their
mismatching columns (match = 0, mismatch = 1, gap = 1).
Written in Java, the program is an implementation of the Hidden Markov Model (HMM) from
S. R. Eddy (2004) with an added state "state 3" that should follow state I. The program lists all paths
with non-zero probabilities that could have generated the sequence 'CTTCATGTGAAAGCAGACGTAAGTCA',
each path's corresponding probability(log), and the best path from those listed.
Written in Java, the program is meant to take two DNA sequences of the same
length and determine the number of mutations between the two sequences.
Written in HTML5 and CSS3, this is my respository on GitHub for everything
that I have done for this website.
Contact
Cell phone: (202) 740-1585
E-mail: epirnia@hawaii.edu
Education
University of Hawaii at Manoa
Bachelor of Science in Computer Science, August 2013 - May 2017
Skills
Languages
Python
Java
Prolog
Lisp
Assembly
Swift
C
C++
HTML
CSS
Javascript
React
Node
SQL
Tools
Git
Linux
Windows
Atom
Vagrant
Google Cloud Platform
AWS
Bash
Volunteer Experience
Association for Computing Machinery at Manoa
President, August 2016 - May 2017
I increased awareness about software development by leading technical outreach workshops for neighboring high schools. I increased my skill set by attending and hosting bi-weekly workshops on web development, hackathons, and professional interaction nights.
Work Experience
Online Learning Academy
Math and Science Tutor, September 2013 - May 2017
I supervised, encouraged, and guided students in Math from Arithmetic to Calculus II. I completed weekly reports and evaluations. I worked as a team to provide students with the best experience possible.
TutorCare
Discrete Math Tutor, August 2016 - December 2017
I provided extra practice and clarification for topics in Discrete Math to my student. We met twice a week, or as needed.
References provided upon request*